• Wyszukiwanie zaawansowane
  • Kategorie
  • Kategorie BISAC
  • Książki na zamówienie
  • Promocje
  • Granty
  • Książka na prezent
  • Opinie
  • Pomoc
  • Załóż konto
  • Zaloguj się

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation » książka

zaloguj się | załóż konto
Logo Krainaksiazek.pl

koszyk

konto

szukaj
topmenu
Księgarnia internetowa
Szukaj
Książki na zamówienie
Promocje
Granty
Książka na prezent
Moje konto
Pomoc
 
 
Wyszukiwanie zaawansowane
Pusty koszyk
Bezpłatna dostawa dla zamówień powyżej 40 złBezpłatna dostawa dla zamówień powyżej 40 zł

Kategorie główne

• Nauka
 [3084821]
• Literatura piękna
 [1818531]

  więcej...
• Turystyka
 [52640]
• Informatyka
 [156433]
• Komiksy
 [36751]
• Encyklopedie
 [23178]
• Dziecięca
 [613236]
• Hobby
 [105326]
• AudioBooki
 [1727]
• Literatura faktu
 [194989]
• Muzyka CD
 [350]
• Słowniki
 [3001]
• Inne
 [441634]
• Kalendarze
 [606]
• Podręczniki
 [166391]
• Poradniki
 [423402]
• Religia
 [510371]
• Czasopisma
 [517]
• Sport
 [61219]
• Sztuka
 [248722]
• CD, DVD, Video
 [3436]
• Technologie
 [230487]
• Zdrowie
 [98718]
• Książkowe Klimaty
 [124]
• Zabawki
 [2526]
• Puzzle, gry
 [3722]
• Literatura w języku ukraińskim
 [258]
• Art. papiernicze i szkolne
 [7792]
Kategorie szczegółowe BISAC

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation

ISBN-13: 9783642741999 / Angielski / Miękka / 2011 / 477 str.

Heinz Lother; Rudolf Dernick; Wolfram Ostertag
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation Heinz Lother Rudolf Dernick Wolfram Ostertag 9783642741999 Springer - książkaWidoczna okładka, to zdjęcie poglądowe, a rzeczywista szata graficzna może różnić się od prezentowanej.

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation

ISBN-13: 9783642741999 / Angielski / Miękka / 2011 / 477 str.

Heinz Lother; Rudolf Dernick; Wolfram Ostertag
cena 544,24
(netto: 518,32 VAT:  5%)

Najniższa cena z 30 dni: 385,52
Termin realizacji zamówienia:
ok. 16-18 dni roboczych.

Darmowa dostawa!

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al., 1986; Miyajima et al., 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al., 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . ."

Kategorie:
Nauka, Biologia i przyroda
Kategorie BISAC:
Science > Cytologia
Medical > Choroby zakaźne
Science > Biologia molekularna
Wydawca:
Springer
Seria wydawnicza:
NATO Asi Series (Closed) / NATO Asi Subseries H: (Closed)
Język:
Angielski
ISBN-13:
9783642741999
Rok wydania:
2011
Wydanie:
Softcover Repri
Numer serii:
000449124
Ilość stron:
477
Waga:
0.83 kg
Wymiary:
24.2 x 17.0
Oprawa:
Miękka
Wolumenów:
01

Why a Workshop on Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation.- Using Embryonal Stem Cells to Introduce Mutations into the Mouse Germ Line.- New Strategies in Developmental Biology: In Vivo Mutagenesis as a Tool to Dissect Mammalian Development.- Visualization by nlsLacZ of Gene Activity during Mouse Embryogenesis.- The Albino Perinatal Lethal Mutation: Identification of Affected mRNAs and Mapping of the Locus by Pulsed-Field Gel Electrophoresis.- Mutations in Transgenic Mice.- Effects of Provirus Insertion on Expression of ?1(I) Collagen Gene in Mov13 Mice.- Cellular Target Sequences for Retrovirus Integration.- Identification of Retroviral Sequences Involved in the Inactivation of the Viral Genome in Embryonal Carcinoma Cells.- Strand Switching during Retroviral Reverse Transcription.- Do Retroviuses Contribute to the Genesis of Intron-less Pseudogenes?.- Biological Activities of Mouse Retrotransposons MURRS/LTR-IS.- Retroviral Receptors and Interference on Human Cells.- Cell Targeting by Recombinant Retroviruses Using Bi-specific Antibody Complexes.- Improvement of Gene Expression and Virus Production in the Use of Retroviral Vectors for Gene Transfer.- New Retroviral Models for Gene Therapy: Swords into Plowshares.- Hemopoietic Regulation Assessed in Clonal Culture: A Brief Overview.- Haemopoietic Cells as Targets for Gene Transfer.- Human (3-globin Expression in Murine Bone Marrow Transplant Recipients Reconstituted with Retrovirally Transduced Stem Cells.- Genetic Manipulation of Human Hematopoietic Stem Cells.- The Role of Cytokines in the Normal and Abnormal Growth of Hemopoietic Cells.- Tumor Necrosis Factor and Interleukin-6: Structure and Mechanism of Action of the Molecular, Cellular and In Vivo Level.- Unexpected Biological Effects of the Deregulated IL-2/IL-2 Receptor System on the Lymphocyte Development.- T Cell Activation Signals and Regulation of Lymphokine Gene by Viral and Cellular Transactivators.- Lymphoid VDJ Recombinase Activity: Development of a Novel Fluorescence- based Assay System.- Meiotic Copy Number Changes at CUPT are Mediated by Gene Conversion.- Epstein-Barr Virus Gene Expression in Normal and Malignant B Cells: Implications for the Immune T Cell Control of EBV Infection.- Suppression of Cellular Gene Activity in Adenovirus-transformed Cells.- Dysregulated Activation of a Haemopoietic Growth Factor Gene alone is Insufficient to Cause Malignent Haemopoietic Disease in Normal Haemopoietic Cells.- Mechanisms of IL-3 Regulated Growth and Transformation of Hematopoietic Cells.- Synergism between Oncogenes in T-cell Lymphogenesis.- The Mouse jun Family.- The c-jun Gene and Its Role in Signal Transduction.- Two Nuclear Oncogene Products Cooperate in the Formation of the Transcription Factor AP-1.- p53: Onco - or Anti-onco - Gene? A Critical Review.- Activation of the Cellular p53 Gene in Friend Virus-transformed Erythroleukemia Cell Lines.- Analysis of Transcriptional Regulatory Regions of the Human p53 Gene in Human Cells Using an EBV-derived Shuttle Vector.- SV40 DNA Replication In Vitro.- Contributors.- Acknowledgements.



Udostępnij

Facebook - konto krainaksiazek.pl



Opinie o Krainaksiazek.pl na Opineo.pl

Partner Mybenefit

Krainaksiazek.pl w programie rzetelna firma Krainaksiaze.pl - płatności przez paypal

Czytaj nas na:

Facebook - krainaksiazek.pl
  • książki na zamówienie
  • granty
  • książka na prezent
  • kontakt
  • pomoc
  • opinie
  • regulamin
  • polityka prywatności

Zobacz:

  • Księgarnia czeska

  • Wydawnictwo Książkowe Klimaty

1997-2026 DolnySlask.com Agencja Internetowa

© 1997-2022 krainaksiazek.pl
     
KONTAKT | REGULAMIN | POLITYKA PRYWATNOŚCI | USTAWIENIA PRYWATNOŚCI
Zobacz: Księgarnia Czeska | Wydawnictwo Książkowe Klimaty | Mapa strony | Lista autorów
KrainaKsiazek.PL - Księgarnia Internetowa
Polityka prywatnosci - link
Krainaksiazek.pl - płatnośc Przelewy24
Przechowalnia Przechowalnia